Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22384-NR
Clone ID PST22384-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST22384-NR
Sequence
TCAGAAATACATAAAATGGTTTTCCATATTTCTGAGGTTGAAGGTAGATGATGTTTTACTGAGTTTTACAACATCTTTTG
TAAAATACCAAATACTGTTGCTTTCTCGGGCTAGATAACAGCATTTCTACTTTCTTGGCTAGAAATTTGACAGTACTTAG
AGCCCCAGAGATGTTGACAGCCTATAGAGTGAATGTTTACCTAGACTGGTGACTTTGACTTATTCTCACTTAAAATTAAA
GATCAAACTCATTTTCTATAACTAGGGGATGTACATCCCAGCAGCACACAAAGGTTCTGCTGGTCTTATTTTCTTTATAA
TTATTGAAGGGAGGGAAGGAAGGACGGAGAGGGAGAGAGAGAGA
Sequence Type genomic DNA
Unitrap ID UNI37447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 83998110..83998473 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]

 
Come back to gene ENSMUSG00000028487


For any suggestions or comments, please send an email to unitrap@crg.es