Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21142-NR
Clone ID PST21142-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21142-NR
Sequence
ATGCAAACCGCATTCCTTTAATCCCAAGACCCTCGAGGGGCAAAGGCAGGCTGATCTCAATGTTCTAAGCCACCCAGGGC
TACAGAGAAACCCTGTCTCAGAAAAGCAAAACAAGCCAAACACTTTTTAAAAAGGTTAGAGTGTCTGTCTCCAGTGTGCC
AGAGGTTCCTTTCCGTGTTGTCAGTGGGGCTTGACTCTTGGGGTTTTCAAGGCTGTGTCTCTGAATGCAAGCCTCTGGTG
GGCTGAGCAAATTGCTCAATGGTGTGTGGTGC
Sequence Type genomic DNA
Unitrap ID UNI23741

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121656393..121656660 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029614 (Rpl6) NM_011290 ribosomal protein L6 Gene [Source:MGI (curated);Acc:Rpl6-001]

 
Come back to gene ENSMUSG00000029614


For any suggestions or comments, please send an email to unitrap@crg.es