Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21327-NR
Clone ID PST21327-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21327-NR
Sequence
GCAACGTGTAGCAACATATTGCAACATAGCCTGGGCCTCACTATGTTGATCCTGCTGACCCCGAGCTCATGGAGCCCCAC
CTGCTTCTGCCTCGAGAGTGCTGGAAATTAAAGCATGC
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155043803..155043920 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es