Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21320-NR
Clone ID PST21320-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21320-NR
Sequence
GTGCTAAGAATTGAACCAGAGCTTGGTTCATGCTGGTCCAGCAGTCTACCAACTGAGCCACACCCTTCCTCACATACATA
TTGTTTATACTCTTTATCATGAGTCCCATTTTATTATTTTCCTACCCGATTCTTTCAGAACATAAACTCCAAAAGGA
Sequence Type genomic DNA
Unitrap ID UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3349603..3349755 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es