Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21526-NR
Clone ID PST21526-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21526-NR
Sequence
GACCAGTACTGGCTTCAAACTCAGGCTACCCACCTGCCGCCCTCTCAAGTGCTGGGAATAAAGA
Sequence Type genomic DNA
Unitrap ID UNI37452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55263742..55263804 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

 
Come back to gene ENSMUSG00000022185


For any suggestions or comments, please send an email to unitrap@crg.es