Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21522-NR
Clone ID PST21522-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21522-NR
Sequence
CACTCACTCCCTGTTTGGGCTCCCGTGGAAAATTCTGGGGAAGAGGCCCAGGTCTTTGATTGCCATATTGAGTGTATTTC
ACGGGAGCCCTTTGGTATCCTGAGCAGGGGCTAGGGCTGTGCCTTCCTTGCAGGCTGTGGGAGCTGTAGGGATGGATGGC
CTGGGCGCTGCATGACCCTGCTCTGCTCTTCACAGAGGGAAGGCTCCTGCATGGCTGAAGATGATGCTGTGGACCATCGA
GCATGC
Sequence Type genomic DNA
Unitrap ID UNI21014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116958067..116958311 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es