Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21242-NR
Clone ID PST21242-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21242-NR
Sequence
TCTGTAGACCAGGCTGGCCTCCAATTCAGAAATCTGCCTGCCTCTGCCTCCGAAGTGCTGGGATTAATGGCATGC
Sequence Type genomic DNA
Unitrap ID UNI37458 UNI37459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 63248853..63248927 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 21226341..21226415 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155260495..155260569 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038369 (Ncoa6) NM_019825 nuclear receptor coactivator 6 Gene [Source:MGI (curated);Acc:Ncoa6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 58668587..58668661 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 151779063..151779137 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 119385862..119385936 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 72328043..72328117 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032750 (Gab3) NM_153073 growth factor receptor bound protein 2-associated protein 3 Gene [Source:MGI (curated);Acc:Gab3-002]

 
Come back to gene ENSMUSG00000032750


For any suggestions or comments, please send an email to unitrap@crg.es