Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST417545
Clone ID OST417545
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST417545
Sequence
GGTAGCATCCAGCCCCAGGTTCTTCAGAGCNTGCACAGCTGTTCATCGAGAGGTATGGCATTGTGGATGGGATATATCAG
TCTCTCTGGCNTTGCCTCCAATATCCAGAGACTTCGTCATGAATTTGATTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18692

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 32052738..32052839 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041444 (Grit) NM_177379 Rho GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:2450166]

 
Come back to gene ENSMUSG00000041444


For any suggestions or comments, please send an email to unitrap@crg.es