Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST20816-NR
Clone ID PST20816-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST20816-NR
Sequence
TTGGGGGCTGGGGGTGGCCTTGGAAAGCGGAGGTGCTCAGCGTAGGAGGTGCCGGAGGCTCACCGGGTCATTCTGGAGCG
GTCAGGCCGAGCTCTGAAGCTGTGGGTAGGGATAGTTAATAGTTCAGTAGTTCTCCGAACTTCATTCCCCAGCTTCTACC
AAAACTCCCCTACTTCTAAGTTGAGATTTTGTGGGAGAGAAAAAGTGAAAGAGACCCTTGTGTACTTGATAAAGTATTTG
GCATAGTGCCTTTTTATGTGTGTGGTGCGATACCAATGAATATTTGGAAAGCTTGGGGGAAGGGTTAAGTNAATACTTGG
TCTGTGCTATCCGCCCTTCTTGATCCCCGAGAGAAGGTGTAACACTTAA
Sequence Type genomic DNA
Unitrap ID UNI10857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36072370..36072730 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]

 
Come back to gene ENSMUSG00000075229


For any suggestions or comments, please send an email to unitrap@crg.es