Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST20542-NR
Clone ID PST20542-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST20542-NR
Sequence
GGTCCAGTCCATGACTGTCACTGTGCAGTGTGACCTTGAGTAAGATACTGGATGGTCCCTGGTCCATGTGAAAAATAAGG
ACATTTCTCTGTTACAGGCCCCTTTGGATTCTGAGGTTGAGTTTGTTGTAGCAAACTTTAAATGAATTTTTACTTGTATA
GTTCAGTGGAATGCACAAGTTATTAGAGCAAAAGCTGCAGGAGAAACTGCCCCGTGTCTTTCTCTTTGCCCAGCGTATTT
GG
Sequence Type genomic DNA
Unitrap ID UNI29912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155755207..155755447 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005882 (Uqcc) NM_018888 ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI (curated);Acc:Uqcc-010]

 
Come back to gene ENSMUSG00000005882


For any suggestions or comments, please send an email to unitrap@crg.es