Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19870-NL
Clone ID PST19870-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST19870-NL
Sequence
TGCCTCCATGCCTGAGACGGGATTTAGCTTTGTAATCCAGTCTGCACTGCTCAGAATCACAGGACGATGTGTGCTTAGCT
AAATCGGGTTCGTTTGAGTGCATATAAGAAAGGTTCTGCTTGAGCATCTGAGGATCCGATGAAAAGCTACAACAGGCT
Sequence Type genomic DNA
Unitrap ID UNI1030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52383213..52383370 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003426 (Rpl13a) NM_009438 ribosomal protein L13a Gene [Source:MGI (curated);Acc:Rpl13a-001]

 
Come back to gene ENSMUSG00000003426


For any suggestions or comments, please send an email to unitrap@crg.es