Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST20604-NR
Clone ID PST20604-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST20604-NR
Sequence
GTTTGTTTGTTTATTTATGGTAGGTAGCCTTGGGAAAGGCTGCAAAAAGGGTTGTTGAAAGTTAGATCAAGTTCTTGAAT
ATGCGTCTTACTTTAAGTAGTGGTGACCTTCCTGATACTGAGAGCAATACATTTGGAAATCTTGTGAATTTATAACTGAT
AATATGGGCAGTTATCCTCTTATGAAACTTAATTCTCTCTCCCAATGATATATATTTAGAATATGGAATAAAAGGAATTT
AGTGATACTGTAAATAACTTTTTTTTTGGGTTTTTGAGACCCAGGGTTTCTCTGTTTACCCCGGGCTTATCTTCAACCTC
CACTTTGTAAACCAGGCTGTTCT
Sequence Type genomic DNA
Unitrap ID UNI1267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3116453..3116791 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

 
Come back to gene ENSMUSG00000046201


For any suggestions or comments, please send an email to unitrap@crg.es