Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST20433-NR
Clone ID PST20433-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST20433-NR
Sequence
CCATATTTGACTAAATTCTTCAAGCGTATGTTAAAAATGTGCTTCCTCCTGCCTTCAGTAGTGCCGGCTTTCTCTTCCCT
TCAGCCCTTAGGCATTTAAAAAGCCTTGATGCCTGCTGGGCCTTTAAATATGCTTTCTCCATGGCTGGGGAGCAAGCTTG
GAGCTTTTAAGGAGTGCGGCAAGTCTTCTCTGACCTACTTCCCTTTGGCTGCACTGCATGC
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25699238..25699456 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es