Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST20300-NR
Clone ID PST20300-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST20300-NR
Sequence
CCACCACGCCCGGCTTTGCTGTTTACTTTTAATTGTGCGTGTGGGTATGTGCATGGGTCTCCTAGACCTGGAGTTATAGA
TGGGCGAGCTGCCAGAGGCCGTGCTGGGAAGTAAAGACTGGTCTTCTGCAAGAGAATACCTGTTCCTTAGCTGCCTGAGC
CATCGCTCCAGCTCCCTTTCGTAATACATTTACCTATAGAATGTACCACCATACTGACCGGTGGTAGGATCTGGTCCACA
GGGTCCCCTGTGAGGACCAGACATGAGTGTTGGTTTCCACTTTGTGAGTGGCATGC
Sequence Type genomic DNA
Unitrap ID UNI17425

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57018229..57018497 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es