Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST20210-NR
Clone ID PST20210-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST20210-NR
Sequence
GGCTAAAGAACCTAAAAGGATACACCGGTTTCTCTGGCAAGCCATGGGCATTAAATTGCAGAATCAGTTAGAGGAACCAG
TGTCACTATCGTTAAATTGACCGCAGTGTGGGTGTTTTCGACATCCCCCTTTCTGAATGAGCTTGCTTTGAAAACTTGTG
TAAAGAACTAGTATTTTCTGGTGGGCGTGGTAGTGCACGCCTTTAGTCTCAGCACTAAGGGAGGCAAAGGTAGGCGGATC
TCTGAAAGACCCTGTCTTGAAAAAGACAAAAACCATGTTTCCCACTAANTTGTTTTCCTTAACNCGTNTCTGTATTTCTC
CCTTTCTTCCTCTTTCTGATATCCATTCTTGATACGTTTTTCACACGTTTGTAT
Sequence Type genomic DNA
Unitrap ID UNI3556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8994286..8994651 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021149 (Gtpbp4) NM_027000 GTP binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916487]

 
Come back to gene ENSMUSG00000021149


For any suggestions or comments, please send an email to unitrap@crg.es