Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST20106-NR
Clone ID PST20106-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST20106-NR
Sequence
GTTTTGTTTTTCAAGACAGGGTTTCTCTGTGTAACCCTGGCTGTCCTGAAACTCACTTTAGTAACTCAGAGCCGGCCTCG
AACTCAGAAATTCACCTGCCTCTGCCTCTACCTCCCAAGTGCTTGGAGATTAAAAGGTGTGCACCACCACACCCAGCTAG
ATGGCTCAACTGTTAAGAGCACTGGCTGTTTTGTGTGTTTGGTTGTTTGATTGTTTTTTAAGAGGACTCAGGTTCCGTTC
CTTGAAGCAACCATGGTATCTCGCAAGTGT
Sequence Type genomic DNA
Unitrap ID UNI10358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148659669..148659933 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038489 (Polr2l) polymerase (RNA) II (DNA directed) polypeptide L Gene [Source:MGI (curated);Acc:Polr2l-001]

 
Come back to gene ENSMUSG00000038489


For any suggestions or comments, please send an email to unitrap@crg.es