Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19869-NR
Clone ID PST19869-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19869-NR
Sequence
GGGTGTCTGTGACCATTACTGAAACCACCCAAATGCCTGTGACCTGGCAGGTGGCAGGAAACCGAGAGGTCTTAGAGACC
TCTTTAGTCTTTCTGTTGTAAATCGTATTTATGTAAAATAATTTAAACTGGGACCAAGCTCCGAGGTATTTAATCCCAGC
ACTCAGGAGACAGAGGCAGGCAAATCTCTGTGAGTTTGAAGCCAGCCTGGTCTGCAGAACAAGTTCTAAGACAGCAGGGG
CTACAAGGAGAACCCCTGTTTTTGTTCAAGGGGGAGGGTCAACGGGTTCTCTAGTACTAGGGTGCTTAATGCAGCAGTCA
CGGGGCCCTGGGCTTGCTCCCAGGCATTAAAAGGACAGAAGACTAGGTGAGGGCTCCG
Sequence Type genomic DNA
Unitrap ID UNI14558

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5849569..5849942 368
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043488 (AC142098.2) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q8CEY4]

 
Come back to gene ENSMUSG00000043488


For any suggestions or comments, please send an email to unitrap@crg.es