Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19804-NR
Clone ID PST19804-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19804-NR
Sequence
CCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTGTATAAGATTCTTCAAGGTGGGGTTGGCATCCCTCACA
TACGGTAAGCACCTTTGGGCACAGAGGGAGTTGCGAAATGGTGAAAGGGGTTGAGGCTGGTAATTGGACCCGATGAATCG
GTCTTGGTGCTGGGTCCTCCAGATTCCACAGTTAACCGTAATCGTTGGGTAATTTTTAATCTCTCCAACTTAGTTGAAAT
TTTGTTTGTTGCACTGCTGCGTNTAGCTNTGTCATTTTNGATNCAGGGCTTNATTTGCAGTTANTTGGAAGTCTTTTGGT
CTAAAAANGTNTGTTTA
Sequence Type genomic DNA
Unitrap ID UNI1453

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61716180..61716487 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024576 (Csnk1a1) NM_146087 casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]

 
Come back to gene ENSMUSG00000024576


For any suggestions or comments, please send an email to unitrap@crg.es