Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19733-NR
Clone ID PST19733-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19733-NR
Sequence
CAGCAGCAAGCCTCAGTAGTTAGGAGCGCTTACTTGTTTGTGTAGAAGACCTGAGTTCAGTTTCTAGCACTCACTAGGCA
GCACACACACAAGCCTGTTACTTGAACTTGGAGGATCCCCTCACTCTGCTGGCCTCCACAGAGCCCCACACACAGATGCA
CACGCACACACACACACACACACAGAGACACAACGTCATCTAATTAAAAATAATGAAGGGAAACCATGACCAAAAAAGAG
TGCCAATGTCTGAGGCTGGATTTGTACGCTTAGTTGGTGAAGTGCTTGTACTACGACAAGACGCACTGGGTTTATGGGTG
TGGTGGTGCATACCCGGAATCCCGTATCCTGGAAATGGAGGGGTGGGGTTAAGGGTATCAAGATGCCTCCCTGGACTACA
TGCCCCGAACGGACGAAGGAATCTTCGTTCGTGGACCCCATGGGCCGAATGCCCTGGCTTGACCGAATTAATCATAC
Sequence Type genomic DNA
Unitrap ID UNI3028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72514816..72515133 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es