Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19651-NL
Clone ID PST19651-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST19651-NL
Sequence
ATACCTAATAAAAAATGGAAAAAAAAAGACTAAGTACTGTACAGAGATTAGTCTGAAAGCTGTTGGACAGTATTTGAGAG
GCATGC
Sequence Type genomic DNA
Unitrap ID UNI34678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8669610..9390529 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031997 (Trpc6) NM_013838 transient receptor potential cation channel, subfamily C, member 6 Gene [Source:MGI Symbol;Acc:MGI:109523]

 
Come back to gene ENSMUSG00000031997


For any suggestions or comments, please send an email to unitrap@crg.es