Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19647-NR
Clone ID PST19647-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19647-NR
Sequence
CAGGTACCTTAAGTGCCTTCTCTACCGTGATCGCCAGACTGTTTGGTGCCTCGGTCTCATCGGGTCTATAATGGGAACTA
TAGAGTCCCCAGCGAAGTAGACCTTGTGAGCTATACCTGTTTCTACGAAGCATGC
Sequence Type genomic DNA
Unitrap ID UNI10492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47165553..47165684 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025047 (Pdcd11) NM_011053 programmed cell death 11 Gene [Source:MGI Symbol;Acc:MGI:1341788]

 
Come back to gene ENSMUSG00000025047


For any suggestions or comments, please send an email to unitrap@crg.es