Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19552-NR
Clone ID PST19552-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19552-NR
Sequence
GTAACAATCCGTATTCCTCCTTTGGAGCGACTCTGGAGAGGGATGATGAGAAGAATTTATGGAGCATGC
Sequence Type genomic DNA
Unitrap ID UNI8511

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72238706..72238774 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039395 (Mreg) NM_001005423 melanoregulin Gene [Source:MGI Symbol;Acc:MGI:2151839]

 
Come back to gene ENSMUSG00000039395


For any suggestions or comments, please send an email to unitrap@crg.es