Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19547-NR
Clone ID PST19547-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19547-NR
Sequence
CCTTGTGTCTTGTGTGCCGAGGACGACTTTGCATAGAATCCTTTCTGACATAGCTGGTAACACTTGGGCTTTCATTCATG
TCTGAACAGCATGATGTAGAAATAAATAAAATCATACCTACGAGTGCATCCAAGACAGAAGCACCGGCAGCCGCAAAGTC
CCTGACATCGCCCCTCGATGACACAGAAGTAAAGAAGGTGATGGAAGAGTGCAGGCGGCAGCAGGAGGAGGTGCAGAGGC
TTCGGGAGGAGAGCAGGCAGCTCAAGGTAACGCCCACCTCCAGGGTCCAGCGGTCATAGCTGGGAAGTGGGGGAGGGGAG
CCTAGAGGGTTTGTTTTGTTTCTTTGCATCTGCTTGCTTTTTCTCCTAAAGGGACATATTTGCAGAG
Sequence Type genomic DNA
Unitrap ID UNI15945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 173601524..173601912 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054455 (Vapb) NM_019806 vesicle-associated membrane protein, associated protein B and C Gene [Source:MGI (curated);Acc:Vapb-001]

 
Come back to gene ENSMUSG00000054455


For any suggestions or comments, please send an email to unitrap@crg.es