Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19319-NR
Clone ID PST19319-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19319-NR
Sequence
ATTGGAGTTCAAAGGGCAGAGCACATTAGAGTTCTGGAAGCACACGGAATGTAATAAAGAGCCTGAGGACTTGGGAACAT
CAGTGGAATTAGCCATGAAGTGTGTTGGCCTGACTCGCTTCCCCATCTAACCCTGTGTAGCAGTGGTTAACTGTAAATCA
TTTTATTATGGGGGGGGGGGGCTCTTCCCAAACGGCAAAGATATCCCCTTTTACACCCCCTGGCCAAACCCCCCGCCTGC
CCCCAATTTTAAAAAAAGGG
Sequence Type genomic DNA
Unitrap ID UNI31336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103408897..103409077 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042757 (Tmem108) NM_178638 transmembrane protein 108 Gene [Source:MGI Symbol;Acc:MGI:1932411]

 
Come back to gene ENSMUSG00000042757


For any suggestions or comments, please send an email to unitrap@crg.es