Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19302-NR
Clone ID PST19302-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19302-NR
Sequence
TAAGTAGAGGCTCCTGGGACACAGAGAGCTAGATGTCATCGGGCCTCAAGCTCAGAAACGGACAGAATCCGCATCGACCC
TCCTCGGCAGCCTCCTGATGCCGAGATGAGAGGCGTGAGCCGTGCCACAAATTCACTGTGTTCCCTCAGTGAAATTCTGT
CAACTTCTACATCCTGTGTGAAAAATCTAAGTCAGGCGACTCACATCCAGGAATCACCCCACAGGGGTTGGCCCAAAAAT
TATAACATTTGGAACTGGGCCTCCAGCCCCTCTTGGAAGAATTTTTATTGAATTTTTCGTTTAANGGCCCTGGAAATGTT
TGGAAAGAACCAAAAAAAAAACCTTTTAAAATTTTCTTTATGTGTTGGCCAAGGTGTTGTTTGGGCCTTAAGTTTTTGGG
GGGTTAATTANGCCCCCCAATTTTTAAAATTTCATTCTTAAAAAAATTGGGCTTTAATTTTCAATTTTTTTTTTTCTAAA
CCCTTGGGCCCCCATTTTTAAATTTTTTGGGCCCCCCCCCCCTTCCCCCTGGGTTTTTTTTAAAACCAAAAAAAAAAGGC
CCCATGTTTNAAAAATTTAAAATTTTTTTTTTTTTTTCCAAAACCTTTAAACCTTTAAACCCCAAGGGGGGGAAAAAAAC
AAAAGGAAAAAACCTTTTTAAAAATTTTTGGGTTTGCCCTTTATTTTGGTTTTTTTTTTTTTTAANANAAT
Sequence Type genomic DNA
Unitrap ID UNI18390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64020175..64020407 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]

 
Come back to gene ENSMUSG00000032400


For any suggestions or comments, please send an email to unitrap@crg.es