Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19227-NR
Clone ID PST19227-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19227-NR
Sequence
GTGCAGGCCTGGGTTCCCTTCCGGTGGGTGTCGGGCCAGCCTGACCTTGGTTTGCCGTGGGTTTCCCTTGCAGATCCTGA
GCTTCCCCAGTCACTCTGGCTCCGAAGCCTCAGCCCGACCCTGCGCCCATCTGCGCCACACACAGACCATTCGCCGGGTG
CTCAAGGTAAGCCAGAGCGCTGGCTGCCATGGCCAGGCTGTGGTCTCCCCTCCCTCCAGGGGCTCTGGCAGGCCTGTCCC
CGTTCTGGACCTTGCCTATGATTGTAAGCCTGCTATTCCCCTTTCCCTGCCCGTGTTGGAAGCCACCGAGCCATACCGAC
GAAGAATATTGTTGAAGTGGTGTTGGTGGAGGCATTGCCCCCGGACGGGCCGAAGGGAATCTCGGTTCGTGACCCCATGG
CGATGCCCTGGCTTGGCCCGAATTATCAATAA
Sequence Type genomic DNA
Unitrap ID UNI37480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6248128..6248414 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024773 (Atg2a) NM_194348 ATG2 autophagy related 2 homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Atg2a-001]

 
Come back to gene ENSMUSG00000024773


For any suggestions or comments, please send an email to unitrap@crg.es