Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19209-NR
Clone ID PST19209-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19209-NR
Sequence
GTACTCTCTTGAGTTAGTTAAGTCTTAGCCTGAGGGCACAGGCAAGTTTTGTTTGCTAATTCAGTTTTCCACCTCTGGTG
TTATTTTAATTCTATGAGTCTATTGCAAATCAATAAATTCAATAAAGTGTGGCTTACTTGTAGTTAAGGTTTTTCTCCCT
TGTATTGACAGCCTCTTTGCTGTTACTTCACTTTACCTGGCTTTTCTGTGTTTTGTTAGTAATCTGAGATAAGATAGCCT
CAACCCATCCCGCTCGTACCCCCACTTCCTTGGTTACATGGATTTTATTTTTGTCCCGTGTTTCATGCATGC
Sequence Type genomic DNA
Unitrap ID UNI34515

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84509673..84509982 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000076437 (2700094K13Rik) NM_001033166 RIKEN cDNA 2700094K13 gene Gene [Source:MGI Symbol;Acc:MGI:1919907]

 
Come back to gene ENSMUSG00000076437


For any suggestions or comments, please send an email to unitrap@crg.es