Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19015-NR
Clone ID PST19015-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19015-NR
Sequence
AGGGCAGCCACTGAGCCGGCTCTCCAGCCCTGACTTTGAACCTCCTGTCTCCACCTCTCAAGTGCCGTGACTAAAAGGCC
TAAAGGCATGGGTTACCATGCCTGGCTAGATATTTATTTTATTTTGCAATGGGGTCCTTTATAGAGAGAGTCATGAGCCA
CCATGTGGTTGCTGAGACTTGAACTCAGGACCTCTGGAAGAGCGGCCATTACTCCTAACTTCTCTCCAGCCCAGCAATGG
AGATCCTTCATGACATAGAGATAGCAGATCGAAGCATGC
Sequence Type genomic DNA
Unitrap ID UNI13632

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100234805..100235082 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es