Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST18778-NR
Clone ID PST18778-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST18778-NR
Sequence
GGTTCATAAGTGGTTTTGCTTATGTAGAGGGGGCACTCTATTGTGCACACCACTTGCATGC
Sequence Type genomic DNA
Unitrap ID UNI37489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32139781..32139841 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044627 (2900010J23Rik) NP_780399 RIKEN cDNA 2900010J23 gene Gene [Source:MGI Symbol;Acc:MGI:1920181]

 
Come back to gene ENSMUSG00000044627


For any suggestions or comments, please send an email to unitrap@crg.es