Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST18689-NR
Clone ID PST18689-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST18689-NR
Sequence
AGTTAACAAGATCTTTTTCCCAAACAACCATTAGCTTGGTGTAAAAAAATTAGTACATGGAATGTAAGGCCTTTGCAAGG
ACACAAGTTTAAAGTTTAGCTTTTCTTAAGGAAAGTCTGATTAAAGGAAAATAAAAAAACCCCCTATTAAAACCTTTTAA
CTTTTTCCCTTGGGTTTTTTTCTCCTCTTCTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI33912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55972612..56197642 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022601 (Rpl24) NM_024218 ribosomal protein L24 Gene [Source:MGI (curated);Acc:Rpl24-005]

 
Come back to gene ENSMUSG00000022601


For any suggestions or comments, please send an email to unitrap@crg.es