Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST18446-NR
Clone ID PST18446-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST18446-NR
Sequence
TCTTCATTTGTATGTCGGATGTTCTCTTGGGCCTTTCTCTGTCCTTTCTTTTGTCTTCTAAGTTGATACAAGTGAGCAAC
ACAGATCACAGCTGTCTTTTTCTTCCTTTGTCCTTCTGTAGGAAGGACACACACCTTTTATACAACTAGAGTTTAAAAGA
GTTAGGTGGAAGTTGTTTGTTTGAATGTTTCAGAAAGGTAGTATACTTGGCAAAATGTTGTATCTGCTCTCTGTCCTCCC
AAGAAATGATTTCAAAGCACCATACTATCATTGTTTTGGCTTCATATTATTATTAATCCTCACAACATTCCTGTAAGGAA
GATAGAGGGTATATGGTATTGTCGCTGTTTTTGTAGGTGGGAAAACATGATGCACACATCTGTTGACTTTCCTAACTTGA
TGTAGTCAGGACCAGAGCAGAGACCCACCTGGCTTCTAAGGCCCATGTTCTATCTTGATTTGACTTTGCTTCATAGGGCA
ACAGA
Sequence Type genomic DNA
Unitrap ID UNI29617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 16086612..16087095 481
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047213 (Ythdf3) NM_172677 YTH domain family 3 Gene [Source:MGI Symbol;Acc:MGI:1918850]

 
Come back to gene ENSMUSG00000047213


For any suggestions or comments, please send an email to unitrap@crg.es