Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST18265-NL
Clone ID PST18265-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST18265-NL
Sequence
TCAATGCGCGCATGTTTCTGTAGACGCAGGCTGGCCTTCAAACTCAGAAATCTGGCCTGCCTCTGGCCTTCCAAGTGCTG
GGATTTTAATAGGCGTGCCTCTCAGTTTCTTATTTCCGAACAGACTGGTCTCAACAGTCCCTGCAGCCCACCAGGGTCAT
ACTTCCCAGTCAGAGTGCGCAGAGGCAGCCATGATGTCAGCTGTCAGCCTTCTGGCTAGATCCTTCTCGGAAGACATCCA
GCCACATAGACACCAATTTCCTTAGGTAGATATGTTCTGAGGTTAATTTTGACCAGACCAAGATTCCATCAATGGCGTTA
ATTAGATTTGAGTCTTTGTTTAATCAGAAAG
Sequence Type genomic DNA
Unitrap ID UNI32177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104165470..104165796 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es