Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST18013-NR
Clone ID PST18013-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST18013-NR
Sequence
ACCTAACATGAACATAATATAAAATATTTCTTACTGTTTTGGAGCACTTAGAAATTGAAATCTCTTGCTCTCAGATGGAT
TTAGCTGTGTGTGTGTTAAGGTCCAGACTCTTATCTTCTGATACTTCTCTCTAATTTAGAAAACAGAGTCCTGTAGTCTG
GAGAAGTTTAAAAGAAAAAATACTTAAAAATCAAAATGATGTCAGCATG
Sequence Type genomic DNA
Unitrap ID UNI11452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4543193..4543401 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019773 (Fbxo5) NM_025995 F-box protein 5 Gene [Source:MGI (curated);Acc:Fbxo5-001]

 
Come back to gene ENSMUSG00000019773


For any suggestions or comments, please send an email to unitrap@crg.es