Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17272-NL
Clone ID PST17272-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST17272-NL
Sequence
CATGCCGCAGCCCTGTGCTGGCCATTGGATGTGGAGCCCCGGGGCTGAGGTCATCCCGGCCTTGTTCTGATCTGCTGCGC
TGCGGCTTCGGGGAGGCCCGAGCCAGACGCTGGTTTTTACTTAGCTTTGATGGCTACCCAGCCAAACGACAAAGGGGTTC
TCTCTCCCATATGCTGCCCGAGCGCTGTAAAGTGCCAGGAAAGGACTGGCAACGTGTGGGTGAAAGTGGTCCTATCTTGA
AAAGTTAGGGTCTTAAGTACCCCCTCTGCGGATGTTGTGCCATGTTGCTCCTGCTTCGCGTTCCTCGTGTGATTCGGGCT
GCCACCCTGTGTACTGTGACTATCCCAGTAGTCAACCATATCATGCTTCCTATCGCACAGACTGGCTAGAGATCGTGTTA
Sequence Type genomic DNA
Unitrap ID UNI13939

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66794271..66794623 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036781 (Rps27l) NM_026467 ribosomal protein S27-like Gene [Source:MGI Symbol;Acc:MGI:1915191]

 
Come back to gene ENSMUSG00000036781


For any suggestions or comments, please send an email to unitrap@crg.es