Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17847-NR
Clone ID PST17847-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17847-NR
Sequence
TGAGGAGTGTGGCCTGGGAGCCACATGAAGGTTCCAAGGGGAGGATTCTGGCCTTTTAAAAGATTAAATGCTACTGGACC
TGGTAGATTGGGAGGGAGGCTGTGTTACTGTGTGCCAGAAAGAAAACTGAGATGTTAGTAATCAGTGAGAGGGGCTAGAA
GATGAGGCTCAGAAATAGAGGGGCAAGAAGTTACTCATGAGCCATCAGGGATAGAAGGGCCAGAAGACCACTGGAGATGG
GCAAGGTGGCTGAAGAAACTACAAAAGCAGAGACCCAGGACCCTGGCTATGGAATGGGAGTCAGTGCCCAGTGGTCCTTG
CTTCCTCCACAACCAAGGGACTAGTGATGTAAGGACAGAAATGGTTAAAGGGACTCAGGAGCCACTGGGAAGACCCAAAT
GCTGGCGAGAGGCCTTGTCACCACCACTGCTACTCCCAGCCTGCCTTTCCTCTGCAAAAGCTGTCTGTGGAACTCACTGC
TCCTTGGGCGTGCTTCAGAGCAGCC
Sequence Type genomic DNA
Unitrap ID UNI37434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72263682..72264043 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040463 (Mybbp1a) NM_016776 MYB binding protein (P160) 1a Gene [Source:MGI (curated);Acc:Mybbp1a-001]

 
Come back to gene ENSMUSG00000040463


For any suggestions or comments, please send an email to unitrap@crg.es