Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17731-NR
Clone ID PST17731-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17731-NR
Sequence
TTTTGAGGCATAGCTTTTCTGTTCTTTCTCCTTTCCTATGGGAAGTGTTTATTGACCAAGTTCTCTGGATTACAGAGGGA
AACTACCATCTTGCCTTCCCCCACCCACTTCCCCACACACTCTTAGAAACTGCACCTGTCCTTCAAACAGCTGTCTTTGT
GGTAAAAGTCAAAGTTCATTTCTTTTATAAGAAAACAATAGGAGCCAGAAGTGTTGCCACACACAAGTAATACCAGCACA
TGGACAAATGAAACGAGAGGATCACAAGTTCAAGATCAGCTGGAGATACATAGTGAAACCCTATCTCACATCTAAGAAAA
GGGGACAGGAAGGGGGGAGACAGGGTCAGTGTAGTATCCTTGTAGCATTATGGGAAAATTTGGGTGCAAGCATCAATTAT
GTTTACTAGATCCA
Sequence Type genomic DNA
Unitrap ID UNI17538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35987102..35987514 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048970 (C1galt1c1) NM_021550 C1GALT1-specific chaperone 1 Gene [Source:MGI (curated);Acc:C1galt1c1-001]

 
Come back to gene ENSMUSG00000048970


For any suggestions or comments, please send an email to unitrap@crg.es