Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17666-NR
Clone ID PST17666-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17666-NR
Sequence
CAGGAAGAAACAGGCGAGGCCTGTGTACCAGTTGCTTTGTCCTAGTGTTTGTAGATAGTAGCTAGGCTTGGGTCAGCCCC
AGCTTTGTACCACTTAGAGAACTAAGGAAGTGGCATCTCACTCTGCACGACCTTTCCATCCTGCTCTCCCAGTTCCGATG
CCTCAACCGCTCAGCCGCCGGAATCGCAGCCACTGCCGGCTTCACAGACGCCTGCCTCCAACCAGCCGAAACGACCCCCA
ACAGCCCCCGAGGTACCTGGAGAACTCGAGGGGTTGGATGAGGAAGAATGACCCTTACGATACTTACTCTGCCCTCCCTG
TGACCATTTGTCCCTTTGCTCCCCCAGAACACTCCTTCGGTTCCAAGCGGGGTAAAGTCCTGGGCACAAGCCAGTGTCAC
CCATGGAGCCCCATGGAGATGGTGAGTGTAAGAGGGTTGGAGCATATGGGAGGGAGGCAGGGGCCATGCATTTTTGAGGA
GAGATCCT
Sequence Type genomic DNA
Unitrap ID UNI37509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35298520..35299006 484
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024393 (Bat2) NM_020027 HLA-B associated transcript 2 Gene [Source:MGI Symbol;Acc:MGI:1915467]

 
Come back to gene ENSMUSG00000024393


For any suggestions or comments, please send an email to unitrap@crg.es