Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17598-NR
Clone ID PST17598-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17598-NR
Sequence
TTGCCTTCCTTCCTTCCTTCTCTTCCTTCCTTCCTTCCTTCCTTCCTTGTTGTTGCTGTTTTGAGACTGGGTTTCTCTAT
GTAGCCCTGGCTGTCCTGGAACTCACTCTATATACCAGACTGGCCTTGAACACTCACAGATCTCCTCCTGCTTCTGCCTC
CCAAGTGGTGAAATTAAAGGCTTGTGCCACCACCTCCCAGCCTTAACCTCGTGGTTTTCAAATGACATGACATCCAGAGT
TTCACAAGGACAGGTTTGGAGGACGGCTCATGAATACCTGCCTTGCCCACTTCTATCCTTGCTCAGCATGC
Sequence Type genomic DNA
Unitrap ID UNI33032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88298299..88298603 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es