Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17138-NL
Clone ID PST17138-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST17138-NL
Sequence
TCTTCAAGGTCGTCGCATGTCATAGAAATTATAGGTTATTATTTAGGGATTTAATTAGTGATATTGAGT
Sequence Type genomic DNA
Unitrap ID UNI37512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 72343356..72343413 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031403 (Dkc1) NM_001030307 dyskeratosis congenita 1, dyskerin homolog (human) Gene [Source:MGI (curated);Acc:Dkc1-001]

 
Come back to gene ENSMUSG00000031403


For any suggestions or comments, please send an email to unitrap@crg.es