Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17523-NR
Clone ID PST17523-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17523-NR
Sequence
CATACAACCTTCCCTACCTGACAGGAACTGGTGGAAAGAAGGCGGACCATGATGGAGGACTTCCGGCAATACCCGGAAAA
TGGCCCAGGAACTCTTACAGTTGGAAGCCAAGGAAAGGAACGAGGCCCGTTCTTAAGGAGCACTTAACCGAAAGGGAAAG
GGGGTAAACCCCAAAAGCCTTTTCCTTGGGGGGCCTTAGGGGTCTGGCCAAGGGTGCAAGTGGGGTTCCCCCCGAAGAGG
GCCCGTTGTCCCCAGGGGGTTCAAGGTTCCTAATGTGGTTTCTTGGTTTCCTTCCTTCCAAGGGGGGGGTTGGGGGAAAC
CAACCCTTGGGAACCGGAAAAGCACTTGGGGGAAACCAAGGCCCAAAACCGGGTTGGGAATTGGAACCTTGGGGGGAGGG
GAAAGAAGAACCAATTGGAAGGTTTTTTTGGTCACACGAGGGAAGGTCATTTCCCTCCTGGGGGAAGTTCAGGGAGGGTG
AAGTCCTCAAGACAACCTTGGTTGGGGTAAAAAGAAATCACTTGTTTGGAAAACCCAACAAGAAAAAAAACCTTAAAGGG
GGAAAAAGTNGGAAAGGGGGGGTGTCCTGGGCCTGGAAACGAAAAGACACCCCCTTGGGACCTNGGCTTTGGTTTTAAAA
AACCANTCCCAACANTGAAAAAGGGACAATNCCCCAAGGAAAGGGGTGGGCCAGTTGGCCTGCCTGGCCTANGTTGGGGG
TTGCCTAAGGGGGAAAGACCTTTGGGGGGAAAAAAANACACAAGAANGGGCCGGGGGCCATT
Sequence Type genomic DNA
Unitrap ID UNI37514

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140918056..140918147 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056076 (Eif3b) NM_133916 eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]

 
Come back to gene ENSMUSG00000056076


For any suggestions or comments, please send an email to unitrap@crg.es