Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17451-NR
Clone ID PST17451-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17451-NR
Sequence
TAACATCTTTAAACTCTGATGGGAACGTTTAGAAGTGGTCTTTTGTTGTCCCTACCCCCACCCCACCCCTTAGTCCAACT
AGGTGGCAGTATACAGACACGTGAAATACTTTTGTATTCAGGTGCTTCCCCTCATTTCTCACATAAAAAATAGTTGCTCA
AGAAGTACATCTGTGACATAGCCTTTTATATAGGGAGGCTGAGTGGAGCCTTGGGAGCTTTCTAAGCCATCTGTTAAGAC
CCCTTTATTTTAGCCTACTAGAAGTTTAAGGAGAAACCTTGCTATGGCTAATTTTTCATACTAAGAAATTGTTTTTTCCT
TTGAGCAAACAGCAACAGCAAGCCTGAAAGGAGGGAATTTTTATTTTCTACCTCCTTGTTCCTAGGCAAATTTCTGTTAG
CCAAATTTACTTTTTCTTTAAGTAATCTAAGAAAGTAAGGTAAATTGCCGTGATGAATATTCTACTTGAGAATTTGTTAC
AGAAAT
Sequence Type genomic DNA
Unitrap ID UNI2374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22256643..22257124 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]

 
Come back to gene ENSMUSG00000022858


For any suggestions or comments, please send an email to unitrap@crg.es