Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17360-NR
Clone ID PST17360-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17360-NR
Sequence
CTTCCACCTTGCGGGTTCTAGGGATTGAACTCAGTTGTTAGGCTTGGCAACAGGCACCCTTACCAGGCTTGCCAGCCTAG
TTTTTCCTACTTTTAAACTGCCTTAATCTAAATCGGAGTTTCTTTTTTTATGAGACCAGATCTTGCTGCCTTGTAGTTTG
CTATGGAGACCAGGCTGGCTTCATCTCACAGAGATCTGCCTCCCAGGGGCTGGGATTAAAGGCCTGGATCACCATGCCTG
GCTCTGTTTGTTAGTTTTTGCTGTTTATGTGTACGATTTGTTTTTCATGAGTGGGATGTGGGTTTGCACATGAGCGCAGG
GCCCAAGGAGGCTGGAAGAGGACGTCAGATAGCCTGGAGCTAAGGTTGAGTCCTGGTTCCTGAAGAGAAACTGGATTCCA
GCCCTTGGCAAAAGCAGCAGATG
Sequence Type genomic DNA
Unitrap ID UNI9054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101553803..101554225 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041431 (Ccnb1) NM_172301 cyclin B1 Gene [Source:MGI (curated);Acc:Ccnb1-001]

 
Come back to gene ENSMUSG00000041431


For any suggestions or comments, please send an email to unitrap@crg.es