Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17349-NR
Clone ID PST17349-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17349-NR
Sequence
AGGTGAGCTGGTCTCTGCCTTACATTGCAATAGTCAGCTTGCTGTGGTCTCTGAGGCTGCTCTCATGCTAGGATCCTAGT
TTGTATATTCTGGGTGCACAAATTATTAGTTATTCCAGTTATGGCAAAAGTAACAGTTTTGTTTTGTCTGAAAAGTAGTT
GGTAGTTTAGGGCTGAGTGATAACTTGGTTTGGAAAAATAACAATGATTTCTGTGTTTTTTGTTTTCAAGACAGGGTTTC
TCTATGTAGCCCCTGGCTGAGTTAGAACTTGCTCTGTAGCCCAGGCTGGCCTCAAACTCTGCCTGCCTCTGCCTCCCAAA
CGCTGGGATTAAAGGCATG
Sequence Type genomic DNA
Unitrap ID UNI29301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96345732..96346070 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040681 (Hmgn1) NM_008251 high mobility group nucleosomal binding domain 1 Gene [Source:MGI (curated);Acc:Hmgn1-001]

 
Come back to gene ENSMUSG00000040681


For any suggestions or comments, please send an email to unitrap@crg.es