Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17342-NR
Clone ID PST17342-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17342-NR
Sequence
AGGGGACACCAGGAAGTGGGAGAGTGTGAAGCAAAGGATACCAAAGTGATAGGAGAGGGCAAATAGCCAAAATGAAACTA
GGCATGGTGGCTCACACCTGTAATCTCAGCACTTAGGGGGTGAGGCAAGGAGGATCTCTGAGTTTATGCCGTACTACCAC
TACTAAATGATATTGATTTTTAAAAATCAGTTTGAATCCTTGTGGTGGAGTACGCCTTTAATCCTAGCACTCGGGAGGCA
GAGGCTAGGAGTTCAAGGTTTGCTTGGTCTACAGAGTGGGTTGCAGGACAGCCAGGGCTA
Sequence Type genomic DNA
Unitrap ID UNI35715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28095865..28096163 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es