Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17328-NR
Clone ID PST17328-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17328-NR
Sequence
AAAGGACTGGCTTGTTCATGTCTCGTGTGTCCTCTCTCCAGGAGAACGTCAGAGCACTGACCAAAGGTGTCCAGGCTGTC
ATGGGTTACAAGCCCGGGCATGGCCTAGGTGACTGCGGCTGCTGCGAGCGCTGAGAATGTACCTGGGAAGCCCTGGAAAA
AACACGGTAACAGAAACCAAAAAAGAGAAAAGCCGTAGGCTCTACAAGCACCTGGATGTGTGAGCTCGGCCTGAACAGAG
ACGGCAGGCAGCTGCGCTGTGCGGGAGGACCCGAGCTCAAACCGCCCTGCTGCTGTCGCTGCTTTGTGCTGCTCTCCTGA
CACACTGCACTGTGCGACTT
Sequence Type genomic DNA
Unitrap ID UNI16437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30561657..30561990 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022538 (Lsg1) NM_178069 large subunit GTPase 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsg1-001]

 
Come back to gene ENSMUSG00000022538


For any suggestions or comments, please send an email to unitrap@crg.es