Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17314-NR
Clone ID PST17314-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17314-NR
Sequence
CTACAACTACCCACTAGGACCCGACGTGTGTCCGCCCTTTCCTTTCAAAAGGCAGAGGAAAAGGGACAGGAAGAATGGAG
GCTTTTGAGTGCTCGTTTCTCAAAAGGCGGGAAAGGCGAACTACACCTCCCGGCGAGCCGCGCGCGCCTGCGCCTGCGCT
CTGGTATCTGTCGCCATCCTTGCCCCTTCTGAGGCACCGCAAACAAACCTAATTCCTGGTGTCCCCCCTAGTCTTGGCGG
AAGGAGCCTTTTTAGATGAGCCCCGAAAAGGCCGGGCAGGTGGGTGTCTCTCAGGCAGGGTCCTGGGAAAAGCTGGCAGG
CTATCCAGGGTAGGGGAGCGCTTGGCCAGGCACGGGGAGCCCGGCTTGGGTCGGTCAGCCCCATCCTCCGTTGTTTCCTA
ACGGGGATCGCGGGGCTCCCCTCAAGTGGACTGAGGGCGCACTCCGGCATG
Sequence Type genomic DNA
Unitrap ID UNI23152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 105804826..105805253 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035401 (2210018M11Rik) NM_172280 RIKEN cDNA 2210018M11 gene Gene [Source:MGI Symbol;Acc:MGI:1924203]

 
Come back to gene ENSMUSG00000035401


For any suggestions or comments, please send an email to unitrap@crg.es