Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17296-NL
Clone ID PST17296-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST17296-NL
Sequence
TCACTCAAGACTCTTGAGCCAACCAGAATCTCTACACAGCTGCCAGTCAAAAAAGTAGGCAGCTCTTCCTGGTTCCAAGC
CAGCAACTTCCTCCCTGTAATTCATCTGATCATTGCGTTTCTGTGGAATGTGTTTTGAGCGCCTCTACTAATTGATGTGA
GGGGACCTCACAAACTCAAAACTCCAGACATGGTAAGTGCAAAGTCATCTGCCACAGAGAG
Sequence Type genomic DNA
Unitrap ID UNI34981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177362806..177363026 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]

 
Come back to gene ENSMUSG00000078865


For any suggestions or comments, please send an email to unitrap@crg.es