Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST17183-NR
Clone ID PST17183-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST17183-NR
Sequence
GTAACTCATGTTTGGGTGTAGTTTCAGGATACAGTCATGGTATAAACTTCCCA
Sequence Type genomic DNA
Unitrap ID UNI16469

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30995828..30995880 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027660 (Skil) NM_011386 SKI-like Gene [Source:MGI (curated);Acc:Skil-001]

 
Come back to gene ENSMUSG00000027660


For any suggestions or comments, please send an email to unitrap@crg.es