Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST16323-NL
Clone ID PST16323-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST16323-NL
Sequence
CTTTCTAGGATGGTTCAATCATGTTGGGAGGATCCTGAGGTGGCACATGGCCAGAGTCATGGTCTGATCAGACTCACCAG
ACAGAATCTCTTCTAACCTAGGCTGGTCTCCCGACTTGGATTGTAGTTGAGGTCTAGCCTTGAACTCCGTCCTCCTGCCT
CTACCTCTCCAGTGTCTAGGATGATGGACACATGGACATAGCTCTCTGCTGGCCTTTTGGTGTCTCTTGTAGAGTCACCG
GGATTGGTGCGATGAAGGCTCCACCTTAGAACCTTCAATATGAGCGGTCATGGTTTAACTTGCGAACCCCTAGGCTATGT
CCAAACCACAGGAGTAATGTTTGAGGGGGGAGTTTGTTTGCTGGTTGTGGCAGAGCATATTAATCTTAGTACTTGGGACT
ACAAGGTCCCACAAGGACTACAATACAAGGACTCTGCCTCAGAAGGGGGCGGGTCCTTGATTCAGGTGGTATTTGGCTGT
GTAGTGGTGTCTATTTGTGAATAGACCCCACCTGTAGGTTTGGACAGT
Sequence Type genomic DNA
Unitrap ID UNI29526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 29319275..29319745 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061477 (Rps7) NM_011300 ribosomal protein S7 Gene [Source:MGI Symbol;Acc:MGI:1333818]

 
Come back to gene ENSMUSG00000061477


For any suggestions or comments, please send an email to unitrap@crg.es