Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST16187-NR
Clone ID PST16187-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST16187-NR
Sequence
CCATCTTAGCATGAGTGATGTGTCGCGACTTGGCCCTGCGGAGACAGTGAATACTGGGGTTTGGGGAGGGGGGGCGTCGG
ATCA
Sequence Type genomic DNA
Unitrap ID UNI4011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 137528260..137528343 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037894 (H2afz) NM_016750 H2A histone family, member Z Gene [Source:MGI (curated);Acc:H2afz-001]

 
Come back to gene ENSMUSG00000037894


For any suggestions or comments, please send an email to unitrap@crg.es